Search results for query: *

Given the "almost chaos" level complexity of building business intelligence enabled enterprise data warehouses in today's world of rapidly changing multi-organization, multi-merger/acquisition, multi-national, multi-lingual corporate world, what are some agile methodologies or practices...

For those of you moving to the wonderful world of 64-bit SQL Server 2005 and SSIS. I want to share a few of the items I have learned along the way. 1. First, make sure your 64-bit SQL 2005 is updates with SP1 and all the hotfixes for SSIS _BEFORE_ deployment of your packages and definitely...

Has anyone architected a project with multiple calendars in the same project? Some of my team's challenge for a supply chain effort is being able to map calendars from different suppliers into the internal distributor's Gregorian/fiscal calendar for purposes of performance comparison. Each...

When I search for a report object in MicroStrategy 8.x web client, the resulting hits provide links to the highest level folder, but not the sub-folder which actually contains the report. Is there a web/client preference or other setting which will provide the fully qualified path to the...

I need to have an attribute's description shown in the heading of a report, whose ID is used in ApplyComparison() filters for each of the metrics contained on the report below. Unfortunately, I also need another attribute on each row of the report which I do *NOT* want filtered by the...

<<Cross posted in the developers forum as well...my apologies...>> HELPPP!!!! I've been stuck updating an ancient MicroStrategy v6.5 project. Only problem is I can't remember how to get a metric threshold to stay put after defining it for a given report. I can define the threshold when the...

Oh Ye of the MicroStrategy Guru's, Customer wants to have the flexibility of a hierarchy prompt (range, in list, between, etc...) that contains only one attribute of a current hierarchy. This I can do. The problem is they want to start with the Qualify tab initially selected in the web...

I'm looking for a reference on how to best to design a class for handling variable length pattern matching in permuations of a variable length string, for a genome search project on which I am embarking. Example: Source CCGGGCACTGATGAGACAGCGGCTGTTTGA Offset 123456789.123456789.123456789...

MicroStrategy v7.2.2 Report requires "Preserve lookup table elements joined to final pass result table based on template attributes w/filter" checked. Not sure if this is an impact, but due to having a report totals metric repeated across all rows, I also have the "Downward Outer Join Option"...

Here's a query to assist in documenting jobs and job steps for purposes of review and analysis the spreadsheet of your choice. select j.job_id , j.name , j.description , j.enabled , j.start_step_id , j.date_created , j.date_modified , s.step_id , s.step_name , s.subsystem ...

Below is a little web API hack I put together to locate static reports (in sub folders named 'UNIT TEST'), generate SQL for each report and capture the SQL into a date/time stamped filename on a drive local to the web server. It can assist with automating some of the mundane checks needed after...

Can someone point me in the right direction on what to change, so reports exported into Excel have their Row and Column Headers unmerged (with respect to Excel) ? Is there an XSL that can be manipulated to modify the default format by project ? The users have requested to be able to manually...

Here's a query I've used to get up to speed on a new project via SQL...You can cut and paste the results into your tool of choice and sort things out... /* SQL Used to generate documentation * Server: MYMETADATA * Database: MSImd; Schema Owner: MSImd * MSI Project Name: MYOLAPDEV *...

Greetings from Business Requirements Hell... Has anyone found a way to use a Microstrategy object prompt to supply a parameter to a SQL Server 2000 user-defined function as part of an ApplySimple() ? The KB indicates it has only been tried and supports the use of "value prompts". I confirmed...